★ Founders price. 40% off the first two years of an annual plan started by June 30, 2027, then the standard price. See the plans →
← Primer database

Primer database

TLR4

toll like receptor 4

Homo sapiens

PublicationGómez-García et al. 2022⇄ Compare with 1 other candidate →

Sequences

Forward (5′→3′)

AGTTTCCTGCAATGGATCAAGG

Reverse (5′→3′)

CTGCTTATCTGAAGGTGTTGCAC

Amplicon

83 bp

Primer Tm (°C)

ConditionsForwardReverseAverageΔ F/R
qPCR master mix62.263.162.60.9
Primer-BLAST default58.960.159.51.2

qPCR master mix: Owczarzy 2004/2008 · 250 nM primer · 50 mM Na⁺ · 3 mM Mg²⁺ · 0.8 mM dNTP

Primer-BLAST default: SantaLucia 1998 salt corr. · 50 nM primer · 50 mM Na⁺ · 1.5 mM Mg²⁺ · 0.6 mM dNTP

Bold, underlined base = 3′ end (polymerase extension point).

Primer QC

GC% · Forward

45.5%

GC% · Reverse

47.8%

Self-dimer ΔG · Fwd (any position)

-3.1 kcal/mol

Self-dimer ΔG · Fwd (3′ end)

-1.1 kcal/mol

Self-dimer ΔG · Rev (any position)

-3.1 kcal/mol

Self-dimer ΔG · Rev (3′ end)

-1.0 kcal/mol

Heterodimer ΔG (F×R, any position)

-4.1 kcal/mol

Heterodimer ΔG (F×R, 3′ end)

0.5 kcal/mol

ΔG at 37 °C · SantaLucia 1998 NN parameters · < −6 kcal/mol = significant dimer risk · "3′ end" is restricted to duplexes anchored at a primer's own 3′ terminal base (polymerase-extendable); "any position" is the most stable duplex anywhere in the primer. Estimated screening value. For comprehensive dimer analysis, validate with Primer3.

Source

PMID

36569197(Europe PMC)

Citation

Gómez-García et al. 2022

Genomic mapping

Ensembl gene

ENSG00000136869 ↗

NCBI Gene ID

7099

Assembly

GRCh38

Cross-check

✓ENST00000472304
✓ENST00000394487
✓ENST00000355622★
✓ENST00001119368
~396bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.3.6kb120bp244bp167bp3.7kb~12.3kbThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.
exon presentprimer binds hereconfirmed amplicongap = exon skipped~bp = boundary varies
How do I read this diagram?

Each row is one transcript, aligned on a shared axis. A gap means that isoform skips this exonic region. Each row's box is drawn at that isoform's own real exon length, which can be narrower than the column (alternative splice site); hover a box for its exact size. A ~amber header bp means isoforms don't all agree on this region's boundary, while a plain header means they do. Navy blocks mark where the primers bind, and green (with a ✓ by the name) means this isoform has a confirmed working amplicon, not just exon overlap. A row with a “‹ exons” / “exons ›” hint instead of any box means that isoform's exons exist but sit outside the current scroll position (a truncated isoform or alternate transcription start site) — click the hint to jump to them. Click a row to load it below.

★ = Ensembl canonical transcript (reference model, not necessarily the most expressed isoform)

Showing: ENST00000472304

396bp17.8kb12.3kb2FRPredicted from the amplicon's own GC%+length (von Ahsen et al. 2001, at the same qPCR buffer as the primer Tm above: 50 mM Na⁺ plus 3 mM Mg²⁺ less 0.8 mM dNTP, as a sodium equivalent), not the SantaLucia model used for primer Tm, which isn't valid at this length. A screening estimate for ranking amplicons — that relation was fitted on oligonucleotide duplexes, so applying it at amplicon length carries more error than its published ±1.9 °C, and it is not a melt-peak prediction.84 bp amplicon · predicted amplicon Tm 82.8 °C
TLR4 · ENST00000472304⚠ Single-exon · may amplify genomic DNA

Off-target specificity

Specific

No paired forward+reverse off-target amplicon found against nt (whole genome/transcriptome). Screen requires >=2 total mismatches including >=2 within the last 5bp at the 3' end to clear a hit (NCBI Primer-BLAST-style stringency); hits with >=6 total mismatches are dropped as implausible.

Efficiency measurements

Ideal range:Dilution series 1.90–2.10·LinRegPCR 1.70–1.90·unknown method: not scored
No measurements yet for this primer pair.

Using these primers?

Analyse your qPCR run with LinRegPCR efficiency correction and a MIQE 2.0 report.

Analyse your data →