★ Founders price. 40% off the first two years of an annual plan started by June 30, 2027, then the standard price. See the plans →
← Primer database

Primer database

NRG1

neuregulin 1

Homo sapiens

PublicationCao et al. 2023

Sequences

Forward (5′→3′)

CGGTGTCCATGCCTTCCAT

Reverse (5′→3′)

GTGTCACGAGAAGTAGAGGTCT

Amplicon

69 bp

estimated from mapping

Primer Tm (°C)

ConditionsForwardReverseAverageΔ F/R
qPCR master mix64.162.263.21.9
Primer-BLAST default60.158.959.51.2

qPCR master mix: Owczarzy 2004/2008 · 250 nM primer · 50 mM Na⁺ · 3 mM Mg²⁺ · 0.8 mM dNTP

Primer-BLAST default: SantaLucia 1998 salt corr. · 50 nM primer · 50 mM Na⁺ · 1.5 mM Mg²⁺ · 0.6 mM dNTP

Bold, underlined base = 3′ end (polymerase extension point).

Primer QC

GC% · Forward

57.9%

GC% · Reverse

50.0%

Self-dimer ΔG · Fwd (any position)

-1.9 kcal/mol

Self-dimer ΔG · Fwd (3′ end)

-0.3 kcal/mol

Self-dimer ΔG · Rev (any position)

-1.0 kcal/mol

Self-dimer ΔG · Rev (3′ end)

-0.5 kcal/mol

Heterodimer ΔG (F×R, any position)

-1.7 kcal/mol

Heterodimer ΔG (F×R, 3′ end)

No duplex found

ΔG at 37 °C · SantaLucia 1998 NN parameters · < −6 kcal/mol = significant dimer risk · "3′ end" is restricted to duplexes anchored at a primer's own 3′ terminal base (polymerase-extendable); "any position" is the most stable duplex anywhere in the primer. Estimated screening value. For comprehensive dimer analysis, validate with Primer3.

Source

PMID

36860211(Europe PMC)

Citation

Cao et al. 2023

Genomic mapping

Ensembl gene

ENSG00000157168 ↗

NCBI Gene ID

3084

Assembly

GRCh38

Cross-check

ENST00000651149
ENST00000520407
ENST00000651335
ENST00000523079
ENST00000650919
ENST00000650967
ENST00000652588
ENST00000518206
ENST00000522569
ENST00000520502
ENST00000523041
ENST00000650819
ENST00000518084
ENST00000522402
ENST00000519240
✓ENST00000519301
✓ENST00000652698
✓ENST00000650866
✓ENST00000523534
✓ENST00000356819
✓ENST00000405005★
✓ENST00000521670
✓ENST00000287842
✓ENST00000650980
✓ENST00000652592
✓ENST00000651333
✓ENST00000943676
~210bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.323bp~975bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.907.5kb~617bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.6.1kb114bp40.8kb178bp9.6kb~122bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.8.7kb~190bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.2.3kb51bp30.1kb~1.4kbThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.73.4kb~290bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.5.9kb~130bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.13.9kb68bp599bp~579bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.6.3kb24bp4.8kb~103bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.1.9kb~127bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.2.8kb131bp763bp~1.8kbThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.1.2kb142bp388bp~10.3kbThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.80.3kb1.3kb
exon presentprimer binds hereconfirmed amplicongap = exon skipped~bp = boundary varies
How do I read this diagram?

Each row is one transcript, aligned on a shared axis. A gap means that isoform skips this exonic region. Each row's box is drawn at that isoform's own real exon length, which can be narrower than the column (alternative splice site); hover a box for its exact size. A ~amber header bp means isoforms don't all agree on this region's boundary, while a plain header means they do. Navy blocks mark where the primers bind, and green (with a ✓ by the name) means this isoform has a confirmed working amplicon, not just exon overlap. A row with a “‹ exons” / “exons ›” hint instead of any box means that isoform's exons exist but sit outside the current scroll position (a truncated isoform or alternate transcription start site) — click the hint to jump to them. Click a row to load it below.

★ = Ensembl canonical transcript (reference model, not necessarily the most expressed isoform)

Showing: ENST00000651149

128bp1956.4kb178bp29.6kb122bp3122.3kb129bp4
NRG1 · ENST00000651149No amplicon found on this isoform (intron_only / intron_only)

Off-target specificity

Specific

No paired forward+reverse off-target amplicon found against nt (whole genome/transcriptome). Screen requires >=2 total mismatches including >=2 within the last 5bp at the 3' end to clear a hit (NCBI Primer-BLAST-style stringency); hits with >=6 total mismatches are dropped as implausible.

Efficiency measurements

Ideal range:Dilution series 1.90–2.10·LinRegPCR 1.70–1.90·unknown method: not scored
No measurements yet for this primer pair.

Using these primers?

Analyse your qPCR run with LinRegPCR efficiency correction and a MIQE 2.0 report.

Analyse your data →