★ Founders price. 40% off the first two years of an annual plan started by June 30, 2027, then the standard price. See the plans →
← Primer database

Primer database

CD4

CD4 molecule

Homo sapiens

PublicationHuang et al. 2024

Sequences

Forward (5′→3′)

CCTCCTGCTTTTCATTGGGCTAG

Reverse (5′→3′)

TGAGGACACTGGCAGGTCTTCT

Amplicon

126 bp

estimated from mapping

Primer Tm (°C)

ConditionsForwardReverseAverageΔ F/R
qPCR master mix64.866.865.81.9
Primer-BLAST default61.563.062.31.5

qPCR master mix: Owczarzy 2004/2008 · 250 nM primer · 50 mM Na⁺ · 3 mM Mg²⁺ · 0.8 mM dNTP

Primer-BLAST default: SantaLucia 1998 salt corr. · 50 nM primer · 50 mM Na⁺ · 1.5 mM Mg²⁺ · 0.6 mM dNTP

Bold, underlined base = 3′ end (polymerase extension point).

Primer QC

GC% · Forward

52.2%

GC% · Reverse

54.5%

Self-dimer ΔG · Fwd (any position)

-1.2 kcal/mol

Self-dimer ΔG · Fwd (3′ end)

-1.2 kcal/mol

Self-dimer ΔG · Rev (any position)

-0.8 kcal/mol

Self-dimer ΔG · Rev (3′ end)

0.7 kcal/mol

Heterodimer ΔG (F×R, any position)

-4.9 kcal/mol

Heterodimer ΔG (F×R, 3′ end)

0.7 kcal/mol

ΔG at 37 °C · SantaLucia 1998 NN parameters · < −6 kcal/mol = significant dimer risk · "3′ end" is restricted to duplexes anchored at a primer's own 3′ terminal base (polymerase-extendable); "any position" is the most stable duplex anywhere in the primer. Estimated screening value. For comprehensive dimer analysis, validate with Primer3.

Source

PMID

39735532(Europe PMC)

Citation

Huang et al. 2024

Genomic mapping

Ensembl gene

ENSG00000010610 ↗

NCBI Gene ID

920

Assembly

GRCh38

Cross-check

✓ENST00000011653★
ENST00000541982
ENST00000539492
✓ENST00000872058
✓ENST00000872059
✓ENST00000872060
✓ENST00000872061
✓ENST00001043478
✓ENST00001143451
~187bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.6.5kb179bp2.5kb195bp463bp86bp448bp116bp119bp~165bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.13.7kb159bp458bp234bp738bp~673bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.726bp201bp1.1kb122bp304bp68bp384bp~1.5kbThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.
exon presentprimer binds hereconfirmed amplicongap = exon skipped~bp = boundary varies
How do I read this diagram?

Each row is one transcript, aligned on a shared axis. A gap means that isoform skips this exonic region. Each row's box is drawn at that isoform's own real exon length, which can be narrower than the column (alternative splice site); hover a box for its exact size. A ~amber header bp means isoforms don't all agree on this region's boundary, while a plain header means they do. Navy blocks mark where the primers bind, and green (with a ✓ by the name) means this isoform has a confirmed working amplicon, not just exon overlap. A row with a “‹ exons” / “exons ›” hint instead of any box means that isoform's exons exist but sit outside the current scroll position (a truncated isoform or alternate transcription start site) — click the hint to jump to them. Click a row to load it below.

★ = Ensembl canonical transcript (reference model, not necessarily the most expressed isoform)

Showing: ENST00000011653 ★

135bp110.4kb116bp2119bp165bp313.7kb159bp4458bp234bp51.1kb348bp6726bp201bp71.1kb122bp8304bp68bp9384bp1.5kb10FRPredicted from the amplicon's own GC%+length (von Ahsen et al. 2001, at the same qPCR buffer as the primer Tm above: 50 mM Na⁺ plus 3 mM Mg²⁺ less 0.8 mM dNTP, as a sodium equivalent), not the SantaLucia model used for primer Tm, which isn't valid at this length. A screening estimate for ranking amplicons — that relation was fitted on oligonucleotide duplexes, so applying it at amplicon length carries more error than its published ±1.9 °C, and it is not a melt-peak prediction.126 bp amplicon · predicted amplicon Tm 88.2 °C
CD4 · ENST00000011653 (NM_001382707) · canonical⚠ Exon-junction spanning · gDNA product still possible (300bp–1.0kb intron)

Off-target specificity

Specific

No paired forward+reverse off-target amplicon found against nt (whole genome/transcriptome). Screen requires >=2 total mismatches including >=2 within the last 5bp at the 3' end to clear a hit (NCBI Primer-BLAST-style stringency); hits with >=6 total mismatches are dropped as implausible.

Efficiency measurements

Ideal range:Dilution series 1.90–2.10·LinRegPCR 1.70–1.90·unknown method: not scored
No measurements yet for this primer pair.

Using these primers?

Analyse your qPCR run with LinRegPCR efficiency correction and a MIQE 2.0 report.

Analyse your data →