★ Founders price. 40% off the first two years of an annual plan started by June 30, 2027, then the standard price. See the plans →
← Primer database

Primer database

Gapdh

glyceraldehyde-3-phosphate dehydrogenase

Rattus norvegicus

PublicationWu et al. 2022⇄ Compare with 4 other candidates →

Sequences

Forward (5′→3′)

GCAAGTTCAACGGCACAG

Reverse (5′→3′)

GCCAGTAGACTCCACGACAT

Amplicon

140 bp

estimated from mapping

Primer Tm (°C)

ConditionsForwardReverseAverageΔ F/R
qPCR master mix61.062.962.01.9
Primer-BLAST default57.459.258.31.8

qPCR master mix: Owczarzy 2004/2008 · 250 nM primer · 50 mM Na⁺ · 3 mM Mg²⁺ · 0.8 mM dNTP

Primer-BLAST default: SantaLucia 1998 salt corr. · 50 nM primer · 50 mM Na⁺ · 1.5 mM Mg²⁺ · 0.6 mM dNTP

Bold, underlined base = 3′ end (polymerase extension point).

Primer QC

GC% · Forward

55.6%

GC% · Reverse

55.0%

Self-dimer ΔG · Fwd (any position)

-0.5 kcal/mol

Self-dimer ΔG · Fwd (3′ end)

No duplex found

Self-dimer ΔG · Rev (any position)

-0.7 kcal/mol

Self-dimer ΔG · Rev (3′ end)

1.2 kcal/mol

Heterodimer ΔG (F×R, any position)

-2.1 kcal/mol

Heterodimer ΔG (F×R, 3′ end)

0.7 kcal/mol

ΔG at 37 °C · SantaLucia 1998 NN parameters · < −6 kcal/mol = significant dimer risk · "3′ end" is restricted to duplexes anchored at a primer's own 3′ terminal base (polymerase-extendable); "any position" is the most stable duplex anywhere in the primer. Estimated screening value. For comprehensive dimer analysis, validate with Primer3.

Source

PMID

36624878(Europe PMC)

Citation

Wu et al. 2022

Genomic mapping

Ensembl gene

ENSRNOG00000018630 ↗

NCBI Gene ID

24383

Assembly

GRCr8

Cross-check

★ = Ensembl canonical transcript (reference model, not necessarily the most expressed isoform)

Showing: ENSRNOT00000050443 ★

98bp11.2kb41bp22.1kb207bp3376bp91bp4383bp198bp5539bp231bp6500bp182bp7559bp269bp8FRPredicted from the amplicon's own GC%+length (von Ahsen et al. 2001, at the same qPCR buffer as the primer Tm above: 50 mM Na⁺ plus 3 mM Mg²⁺ less 0.8 mM dNTP, as a sodium equivalent), not the SantaLucia model used for primer Tm, which isn't valid at this length. A screening estimate for ranking amplicons — that relation was fitted on oligonucleotide duplexes, so applying it at amplicon length carries more error than its published ±1.9 °C, and it is not a melt-peak prediction.140 bp amplicon · predicted amplicon Tm 87.8 °C
Gapdh · ENSRNOT00000050443 (NM_017008) · canonical⚠ Exon-junction spanning · gDNA product still possible (300bp–1.0kb intron)

Off-target specificity

Specific

No paired forward+reverse off-target amplicon found against nt (whole genome/transcriptome). Screen requires >=2 total mismatches including >=2 within the last 5bp at the 3' end to clear a hit (NCBI Primer-BLAST-style stringency); hits with >=6 total mismatches are dropped as implausible.

Efficiency measurements

Ideal range:Dilution series 1.90–2.10·LinRegPCR 1.70–1.90·unknown method: not scored
No measurements yet for this primer pair.

Using these primers?

Analyse your qPCR run with LinRegPCR efficiency correction and a MIQE 2.0 report.

Analyse your data →