★ Founders price. 40% off the first two years of an annual plan started by June 30, 2027, then the standard price. See the plans →
← Primer database

Primer database

STAT1

signal transducer and activator of transcription 1

Homo sapiens

PublicationCorrea et al. 2024⇄ Compare with 2 other candidates →

Sequences

Forward (5′→3′)

ATTCGACAGTATGATGAACACAGTATAG

Reverse (5′→3′)

TCCCTAGAAACACAGGATGTGA

Amplicon

125 bp

estimated from mapping

Primer Tm (°C)

ConditionsForwardReverseAverageΔ F/R
qPCR master mix61.461.961.70.5
Primer-BLAST default59.258.558.80.7

qPCR master mix: Owczarzy 2004/2008 · 250 nM primer · 50 mM Na⁺ · 3 mM Mg²⁺ · 0.8 mM dNTP

Primer-BLAST default: SantaLucia 1998 salt corr. · 50 nM primer · 50 mM Na⁺ · 1.5 mM Mg²⁺ · 0.6 mM dNTP

Bold, underlined base = 3′ end (polymerase extension point).

Primer QC

GC% · Forward

35.7%

GC% · Reverse

45.5%

Self-dimer ΔG · Fwd (any position)

-2.7 kcal/mol

Self-dimer ΔG · Fwd (3′ end)

No duplex found

Self-dimer ΔG · Rev (any position)

-2.4 kcal/mol

Self-dimer ΔG · Rev (3′ end)

0.7 kcal/mol

Heterodimer ΔG (F×R, any position)

-2.4 kcal/mol

Heterodimer ΔG (F×R, 3′ end)

0.1 kcal/mol

ΔG at 37 °C · SantaLucia 1998 NN parameters · < −6 kcal/mol = significant dimer risk · "3′ end" is restricted to duplexes anchored at a primer's own 3′ terminal base (polymerase-extendable); "any position" is the most stable duplex anywhere in the primer. Estimated screening value. For comprehensive dimer analysis, validate with Primer3.

Source

PMID

38288122(Europe PMC)

Citation

Correa et al. 2024

Genomic mapping

Ensembl gene

ENSG00000115415 ↗

NCBI Gene ID

6772

Assembly

GRCh38

Cross-check

ENST00000673816
ENST00000673847
ENST00000698145
ENST00000673952
ENST00000392322
ENST00000673841
ENST00000392323
ENST00000424722
ENST00000454414
ENST00000432058
ENST00000996919
ENST00001036716
ENST00001036719
ENST00001036720
ENST00001109845
ENST00001112429
✓ENST00000698141
✓ENST00000698142
✓ENST00000361099★
✓ENST00000540176
✓ENST00000673777
✓ENST00000673942
✓ENST00000409465
✓ENST00000856926
✓ENST00000856927
✓ENST00000856928
✓ENST00000922629
✓ENST00000950377
✓ENST00000950378
✓ENST00000950379
✓ENST00000950380
✓ENST00000950381
✓ENST00001036713
✓ENST00001145300
203bp121bp~214bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~445bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.83bp129bp~145bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~5.5kbThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~90bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~79bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.92bp152bp159bp93bp60bp30bp~94bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.42bp84bp99bp136bp50bp95bp146bp186bp~375bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~884bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~5.3kbThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.65bp~955bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.541bp
exon presentprimer binds hereconfirmed amplicongap = exon skipped~bp = boundary varies
How do I read this diagram?

Each row is one transcript, aligned on a shared axis. A gap means that isoform skips this exonic region. Each row's box is drawn at that isoform's own real exon length, which can be narrower than the column (alternative splice site); hover a box for its exact size. A ~amber header bp means isoforms don't all agree on this region's boundary, while a plain header means they do. Navy blocks mark where the primers bind, and green (with a ✓ by the name) means this isoform has a confirmed working amplicon, not just exon overlap. A row with a “‹ exons” / “exons ›” hint instead of any box means that isoform's exons exist but sit outside the current scroll position (a truncated isoform or alternate transcription start site) — click the hint to jump to them. Click a row to load it below.

★ = Ensembl canonical transcript (reference model, not necessarily the most expressed isoform)

Showing: ENST00000673816

214bp1705bp154bp23.8kb129bp31.0kb145bp41.5kb99bp56.6kb90bp61.5kb79bp71.5kb92bp8451bp152bp92.9kb159bp104.0kb93bp111.7kb60bp122.6kb30bp13213bp94bp141.3kb42bp151.3kb84bp16750bp99bp171.4kb136bp181.9kb50bp19896bp95bp201.0kb146bp212.2kb186bp221.2kb76bp231.1kb103bp2466.5kb541bp25
STAT1 · ENST00000673816No amplicon found on this isoform (intron_only / intron_only)

Off-target specificity

Specific

No paired forward+reverse off-target amplicon found against nt (whole genome/transcriptome). Screen requires >=2 total mismatches including >=2 within the last 5bp at the 3' end to clear a hit (NCBI Primer-BLAST-style stringency); hits with >=6 total mismatches are dropped as implausible.

Efficiency measurements

Ideal range:Dilution series 1.90–2.10·LinRegPCR 1.70–1.90·unknown method: not scored
No measurements yet for this primer pair.

Using these primers?

Analyse your qPCR run with LinRegPCR efficiency correction and a MIQE 2.0 report.

Analyse your data →