★ Founders price. 40% off the first two years of an annual plan started by June 30, 2027, then the standard price. See the plans →
← Primer database

Primer database

Sirt2

sirtuin 2

Mus musculus

PublicationSiddique et al. 2022

Sequences

Forward (5′→3′)

AGCCGGACCGATTCAGACT

Reverse (5′→3′)

TTCGAGGGTCAGCTCGTCTA

Amplicon

141 bp

estimated from mapping

Primer Tm (°C)

ConditionsForwardReverseAverageΔ F/R
qPCR master mix64.863.864.31.0
Primer-BLAST default60.760.060.40.6

qPCR master mix: Owczarzy 2004/2008 · 250 nM primer · 50 mM Na⁺ · 3 mM Mg²⁺ · 0.8 mM dNTP

Primer-BLAST default: SantaLucia 1998 salt corr. · 50 nM primer · 50 mM Na⁺ · 1.5 mM Mg²⁺ · 0.6 mM dNTP

Bold, underlined base = 3′ end (polymerase extension point).

Primer QC

GC% · Forward

57.9%

GC% · Reverse

55.0%

Self-dimer ΔG · Fwd (any position)

-3.9 kcal/mol

Self-dimer ΔG · Fwd (3′ end)

0.7 kcal/mol

Self-dimer ΔG · Rev (any position)

-2.8 kcal/mol

Self-dimer ΔG · Rev (3′ end)

1.5 kcal/mol

Heterodimer ΔG (F×R, any position)

-2.7 kcal/mol

Heterodimer ΔG (F×R, 3′ end)

0.7 kcal/mol

ΔG at 37 °C · SantaLucia 1998 NN parameters · < −6 kcal/mol = significant dimer risk · "3′ end" is restricted to duplexes anchored at a primer's own 3′ terminal base (polymerase-extendable); "any position" is the most stable duplex anywhere in the primer. Estimated screening value. For comprehensive dimer analysis, validate with Primer3.

Source

PMID

36582489(Europe PMC)

Citation

Siddique et al. 2022

Genomic mapping

Ensembl gene

ENSMUSG00000015149 ↗

NCBI Gene ID

64383

Assembly

GRCm39

Cross-check

ENSMUST00000072965
ENSMUST00000170068
ENSMUST00000155327
ENSMUST00000453713
ENSMUST00000453715
ENSMUST00000453718
ENSMUST00000453729
ENSMUST00000453731
ENSMUST00000453732
ENSMUST00000453734
ENSMUST00000453737
ENSMUST00000453738
ENSMUST00000453739
ENSMUST00000453740
ENSMUST00000453746
ENSMUST00000453748
ENSMUST00000453749
ENSMUST00000453750
ENSMUST00000453751
ENSMUST00000579105
ENSMUST00000579106
✓ENSMUST00000122915★
✓ENSMUST00000453717
✓ENSMUST00000453719
✓ENSMUST00000453722
✓ENSMUST00000453724
✓ENSMUST00000453725
✓ENSMUST00000453735
✓ENSMUST00000453745
✓ENSMUST00000562901
✓ENSMUST00000579104
~133bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.28bp~139bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.196bp~448bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.1.8kb~190bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.2.1kb~49bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.235bp114bp4.6kb42bp96bp107bp88bp57bp1.7kb69bp3.8kb130bp2.5kb~60bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.224bp56bp86bp~77bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.82bp~52bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.1.6kb~71bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.78bp~97bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.88bp~749bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.
exon presentprimer binds hereconfirmed amplicongap = exon skipped~bp = boundary varies
How do I read this diagram?

Each row is one transcript, aligned on a shared axis. A gap means that isoform skips this exonic region. Each row's box is drawn at that isoform's own real exon length, which can be narrower than the column (alternative splice site); hover a box for its exact size. A ~amber header bp means isoforms don't all agree on this region's boundary, while a plain header means they do. Navy blocks mark where the primers bind, and green (with a ✓ by the name) means this isoform has a confirmed working amplicon, not just exon overlap. A row with a “‹ exons” / “exons ›” hint instead of any box means that isoform's exons exist but sit outside the current scroll position (a truncated isoform or alternate transcription start site) — click the hint to jump to them. Click a row to load it below.

★ = Ensembl canonical transcript (reference model, not necessarily the most expressed isoform)

Showing: ENSMUST00000072965

133bp1764bp47bp24.1kb49bp3235bp114bp44.6kb42bp596bp107bp688bp57bp71.7kb69bp83.8kb130bp92.5kb60bp10224bp56bp1186bp77bp1282bp52bp131.6kb71bp14108bp67bp1588bp744bp16R
Sirt2 · ENSMUST00000072965 (NM_022432)No amplicon found on this isoform (intron_only / exon_only)

Off-target specificity

Specific

No paired forward+reverse off-target amplicon found against nt (whole genome/transcriptome). Screen requires >=2 total mismatches including >=2 within the last 5bp at the 3' end to clear a hit (NCBI Primer-BLAST-style stringency); hits with >=6 total mismatches are dropped as implausible.

Efficiency measurements

Ideal range:Dilution series 1.90–2.10·LinRegPCR 1.70–1.90·unknown method: not scored
No measurements yet for this primer pair.

Using these primers?

Analyse your qPCR run with LinRegPCR efficiency correction and a MIQE 2.0 report.

Analyse your data →