★ Founders price. 40% off the first two years of an annual plan started by June 30, 2027, then the standard price. See the plans →
← Primer database

Primer database

NCAPD3

non-SMC condensin II complex subunit D3

Homo sapiens

PublicationShen et al. 2025

Sequences

Forward (5′→3′)

GCAGAGACACCAGCAGAGGAG

Reverse (5′→3′)

CCAACAGGTCTTCGTCCATATTCC

Amplicon

133 bp

estimated from mapping

Primer Tm (°C)

ConditionsForwardReverseAverageΔ F/R
qPCR master mix66.364.365.32.0
Primer-BLAST default62.461.261.81.2

qPCR master mix: Owczarzy 2004/2008 · 250 nM primer · 50 mM Na⁺ · 3 mM Mg²⁺ · 0.8 mM dNTP

Primer-BLAST default: SantaLucia 1998 salt corr. · 50 nM primer · 50 mM Na⁺ · 1.5 mM Mg²⁺ · 0.6 mM dNTP

Bold, underlined base = 3′ end (polymerase extension point).

Primer QC

GC% · Forward

61.9%

GC% · Reverse

50.0%

Self-dimer ΔG · Fwd (any position)

-0.3 kcal/mol

Self-dimer ΔG · Fwd (3′ end)

No duplex found

Self-dimer ΔG · Rev (any position)

-0.3 kcal/mol

Self-dimer ΔG · Rev (3′ end)

0.1 kcal/mol

Heterodimer ΔG (F×R, any position)

-2.1 kcal/mol

Heterodimer ΔG (F×R, 3′ end)

-1.1 kcal/mol

ΔG at 37 °C · SantaLucia 1998 NN parameters · < −6 kcal/mol = significant dimer risk · "3′ end" is restricted to duplexes anchored at a primer's own 3′ terminal base (polymerase-extendable); "any position" is the most stable duplex anywhere in the primer. Estimated screening value. For comprehensive dimer analysis, validate with Primer3.

Source

PMID

39944401(Europe PMC)

Citation

Shen et al. 2025

Genomic mapping

Ensembl gene

ENSG00000151503 ↗

NCBI Gene ID

23310

Assembly

GRCh38

Cross-check

ENST00000686368
✓ENST00000534548★
ENST00000526787
✓ENST00000688672
ENST00000691025
✓ENST00000688263
✓ENST00000685324
ENST00000532445
ENST00000526422
✓ENST00000912040
✓ENST00000912041
✓ENST00000957779
✓ENST00000957780
✓ENST00000957781
✓ENST00000957782
ENST00000981273
ENST00001096480
✓ENST00001143607
408bp~698bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~2.1kbThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~155bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.163bp~185bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.165bp62bp88bp134bp73bp126bp253bp57bp90bp74bp~135bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.221bp192bp98bp116bp108bp115bp108bp~239bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.80bp138bp134bp200bp111bp~183bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.167bp140bp78bp87bp75bp61bp~4.0kbThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.
exon presentprimer binds hereconfirmed amplicongap = exon skipped~bp = boundary varies
How do I read this diagram?

Each row is one transcript, aligned on a shared axis. A gap means that isoform skips this exonic region. Each row's box is drawn at that isoform's own real exon length, which can be narrower than the column (alternative splice site); hover a box for its exact size. A ~amber header bp means isoforms don't all agree on this region's boundary, while a plain header means they do. Navy blocks mark where the primers bind, and green (with a ✓ by the name) means this isoform has a confirmed working amplicon, not just exon overlap. A row with a “‹ exons” / “exons ›” hint instead of any box means that isoform's exons exist but sit outside the current scroll position (a truncated isoform or alternate transcription start site) — click the hint to jump to them. Click a row to load it below.

★ = Ensembl canonical transcript (reference model, not necessarily the most expressed isoform)

Showing: ENST00000686368

140bp11.0kb78bp23.8kb75bp3222bp61bp43.1kb471bp5
NCAPD3 · ENST00000686368No amplicon found on this isoform (intron_only / intron_only)

Off-target specificity

Specific

No paired forward+reverse off-target amplicon found against nt (whole genome/transcriptome). Screen requires >=2 total mismatches including >=2 within the last 5bp at the 3' end to clear a hit (NCBI Primer-BLAST-style stringency); hits with >=6 total mismatches are dropped as implausible.

Efficiency measurements

Ideal range:Dilution series 1.90–2.10·LinRegPCR 1.70–1.90·unknown method: not scored
No measurements yet for this primer pair.

Using these primers?

Analyse your qPCR run with LinRegPCR efficiency correction and a MIQE 2.0 report.

Analyse your data →