★ Founders price. 40% off the first two years of an annual plan started by June 30, 2027, then the standard price. See the plans →
← Primer database

Primer database

SEPTIN4

septin 4

Homo sapiens

PublicationCorrea et al. 2024⇄ Compare with 1 other candidate →

Sequences

Forward (5′→3′)

CTGGTCTTCTCTGACTCTCTG

Reverse (5′→3′)

TGAGAAATCCTTCACGAACTTG

Amplicon

90 bp

estimated from mapping

Primer Tm (°C)

ConditionsForwardReverseAverageΔ F/R
qPCR master mix60.459.560.00.9
Primer-BLAST default56.956.756.80.2

qPCR master mix: Owczarzy 2004/2008 · 250 nM primer · 50 mM Na⁺ · 3 mM Mg²⁺ · 0.8 mM dNTP

Primer-BLAST default: SantaLucia 1998 salt corr. · 50 nM primer · 50 mM Na⁺ · 1.5 mM Mg²⁺ · 0.6 mM dNTP

Bold, underlined base = 3′ end (polymerase extension point).

Primer QC

GC% · Forward

52.4%

GC% · Reverse

40.9%

Self-dimer ΔG · Fwd (any position)

-0.8 kcal/mol

Self-dimer ΔG · Fwd (3′ end)

No duplex found

Self-dimer ΔG · Rev (any position)

-0.7 kcal/mol

Self-dimer ΔG · Rev (3′ end)

0.5 kcal/mol

Heterodimer ΔG (F×R, any position)

-2.9 kcal/mol

Heterodimer ΔG (F×R, 3′ end)

0.5 kcal/mol

ΔG at 37 °C · SantaLucia 1998 NN parameters · < −6 kcal/mol = significant dimer risk · "3′ end" is restricted to duplexes anchored at a primer's own 3′ terminal base (polymerase-extendable); "any position" is the most stable duplex anywhere in the primer. Estimated screening value. For comprehensive dimer analysis, validate with Primer3.

Source

PMID

38288122(Europe PMC)

Citation

Correa et al. 2024

Genomic mapping

Ensembl gene

ENSG00000108387 ↗

NCBI Gene ID

5414

Assembly

GRCh38

Cross-check

ENST00000393086
ENST00000583114
ENST00000672673★
ENST00000426861
ENST00000579371
ENST00000317268
ENST00000580844
ENST00000317256
ENST00000412945
ENST00000580809
ENST00000577729
ENST00000583291
ENST00000671766
ENST00000581607
ENST00000321691
ENST00001142938
✓ENST00000457347
~1.7kbThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~380bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~153bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.97bp~115bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~462bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~237bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.156bp3bp~297bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.94bp87bp~124bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~557bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.97bp~418bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~517bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.
exon presentprimer binds hereconfirmed amplicongap = exon skipped~bp = boundary varies
How do I read this diagram?

Each row is one transcript, aligned on a shared axis. A gap means that isoform skips this exonic region. Each row's box is drawn at that isoform's own real exon length, which can be narrower than the column (alternative splice site); hover a box for its exact size. A ~amber header bp means isoforms don't all agree on this region's boundary, while a plain header means they do. Navy blocks mark where the primers bind, and green (with a ✓ by the name) means this isoform has a confirmed working amplicon, not just exon overlap. A row with a “‹ exons” / “exons ›” hint instead of any box means that isoform's exons exist but sit outside the current scroll position (a truncated isoform or alternate transcription start site) — click the hint to jump to them. Click a row to load it below.

★ = Ensembl canonical transcript (reference model, not necessarily the most expressed isoform)

Showing: ENST00000393086

1 (3bp)461bp297bp2757bp94bp3617bp87bp4702bp124bp53.2kb135bp6364bp118bp7307bp102bp8391bp97bp9351bp163bp10416bp100bp11591bp236bp12R
SEPTIN4 · ENST00000393086No amplicon found on this isoform (intron_only / exon_only)

Off-target specificity

Specific

No paired forward+reverse off-target amplicon found against nt (whole genome/transcriptome). Screen requires >=2 total mismatches including >=2 within the last 5bp at the 3' end to clear a hit (NCBI Primer-BLAST-style stringency); hits with >=6 total mismatches are dropped as implausible.

Efficiency measurements

Ideal range:Dilution series 1.90–2.10·LinRegPCR 1.70–1.90·unknown method: not scored
No measurements yet for this primer pair.

Using these primers?

Analyse your qPCR run with LinRegPCR efficiency correction and a MIQE 2.0 report.

Analyse your data →