★ Founders price. 40% off the first two years of an annual plan started by June 30, 2027, then the standard price. See the plans →
← Primer database

Primer database

GPM6A

glycoprotein M6A

Homo sapiens

PublicationZhang et al. 2022

Sequences

Forward (5′→3′)

TCTGCCGGAACACCACATTAG

Reverse (5′→3′)

GTAGATTCGCACATCCTCAAGAA

Amplicon

133 bp

estimated from mapping

Primer Tm (°C)

ConditionsForwardReverseAverageΔ F/R
qPCR master mix63.861.462.62.4
Primer-BLAST default60.358.659.51.8

qPCR master mix: Owczarzy 2004/2008 · 250 nM primer · 50 mM Na⁺ · 3 mM Mg²⁺ · 0.8 mM dNTP

Primer-BLAST default: SantaLucia 1998 salt corr. · 50 nM primer · 50 mM Na⁺ · 1.5 mM Mg²⁺ · 0.6 mM dNTP

Bold, underlined base = 3′ end (polymerase extension point).

Primer QC

GC% · Forward

52.4%

GC% · Reverse

43.5%

Self-dimer ΔG · Fwd (any position)

-3.9 kcal/mol

Self-dimer ΔG · Fwd (3′ end)

0.7 kcal/mol

Self-dimer ΔG · Rev (any position)

-0.3 kcal/mol

Self-dimer ΔG · Rev (3′ end)

-0.3 kcal/mol

Heterodimer ΔG (F×R, any position)

-1.7 kcal/mol

Heterodimer ΔG (F×R, 3′ end)

0.7 kcal/mol

ΔG at 37 °C · SantaLucia 1998 NN parameters · < −6 kcal/mol = significant dimer risk · "3′ end" is restricted to duplexes anchored at a primer's own 3′ terminal base (polymerase-extendable); "any position" is the most stable duplex anywhere in the primer. Estimated screening value. For comprehensive dimer analysis, validate with Primer3.

Source

PMID

36405247(Europe PMC)

Citation

Zhang et al. 2022

Genomic mapping

Ensembl gene

ENSG00000150625 ↗

NCBI Gene ID

2823

Assembly

GRCh38

Cross-check

✓ENST00000280187
✓ENST00000393658★
✓ENST00000506894
✓ENST00000515090
✓ENST00000503397
ENST00000512610
ENST00000502754
ENST00000507520
ENST00000513667
ENST00000512509
ENST00000505561
ENST00000505375
ENST00000513365
ENST00000509865
ENST00000512897
ENST00000507540
ENST00000505304
ENST00000503563
✓ENST00000909881
✓ENST00000909882
✓ENST00000909883
✓ENST00000909884
✓ENST00000909885
✓ENST00000909886
✓ENST00000909887
✓ENST00000909888
✓ENST00000909889
✓ENST00000909890
✓ENST00000909891
✓ENST00000966481
✓ENST00000966482
✓ENST00000966483
✓ENST00000966484
✓ENST00000966485
✓ENST00000966486
✓ENST00000966487
✓ENST00001139417
82bp~356bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~974bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~142bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~95bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~420bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.16bp145bp54bp104bp67bp~274bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.199bp~292bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.95bp~71bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~430bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.270bp~301bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~341bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.46bp89bp~193bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~157bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~161bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.77bp~66bpThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.~2.8kbThis is the outer span across every isoform's exon here. They don't all agree on the exact boundary (alternative splice site), so hover a row's own box below for its real length.
exon presentprimer binds hereconfirmed amplicongap = exon skipped~bp = boundary varies
How do I read this diagram?

Each row is one transcript, aligned on a shared axis. A gap means that isoform skips this exonic region. Each row's box is drawn at that isoform's own real exon length, which can be narrower than the column (alternative splice site); hover a box for its exact size. A ~amber header bp means isoforms don't all agree on this region's boundary, while a plain header means they do. Navy blocks mark where the primers bind, and green (with a ✓ by the name) means this isoform has a confirmed working amplicon, not just exon overlap. A row with a “‹ exons” / “exons ›” hint instead of any box means that isoform's exons exist but sit outside the current scroll position (a truncated isoform or alternate transcription start site) — click the hint to jump to them. Click a row to load it below.

★ = Ensembl canonical transcript (reference model, not necessarily the most expressed isoform)

Showing: ENST00000280187

24bp1190.1kb59bp2110.7kb193bp328.1kb157bp422.0kb154bp511.2kb77bp6699bp66bp78.0kb2.8kb8FRPredicted from the amplicon's own GC%+length (von Ahsen et al. 2001, at the same qPCR buffer as the primer Tm above: 50 mM Na⁺ plus 3 mM Mg²⁺ less 0.8 mM dNTP, as a sodium equivalent), not the SantaLucia model used for primer Tm, which isn't valid at this length. A screening estimate for ranking amplicons — that relation was fitted on oligonucleotide duplexes, so applying it at amplicon length carries more error than its published ±1.9 °C, and it is not a melt-peak prediction.133 bp amplicon · predicted amplicon Tm 83.5 °C
GPM6A · ENST00000280187 (NM_005277)✓ Exon-junction spanning · gDNA-safe (>1.0kb intron)

Off-target specificity

Specific

No paired forward+reverse off-target amplicon found against nt (whole genome/transcriptome). Screen requires >=2 total mismatches including >=2 within the last 5bp at the 3' end to clear a hit (NCBI Primer-BLAST-style stringency); hits with >=6 total mismatches are dropped as implausible.

Efficiency measurements

Ideal range:Dilution series 1.90–2.10·LinRegPCR 1.70–1.90·unknown method: not scored
No measurements yet for this primer pair.

Using these primers?

Analyse your qPCR run with LinRegPCR efficiency correction and a MIQE 2.0 report.

Analyse your data →