★ Founders price. 40% off the first two years of an annual plan started by June 30, 2027, then the standard price. See the plans →
← Primer database

Primer database

Kdm6b

KDM1 lysine (K)-specific demethylase 6B

Mus musculus

PublicationHuangfu et al. 2025

Sequences

Forward (5′→3′)

TGAAGAACGTCAAGTCCATTGTG

Reverse (5′→3′)

TCCCGCTGTACCTGACAGT

Amplicon

142 bp

estimated from mapping

Primer Tm (°C)

ConditionsForwardReverseAverageΔ F/R
qPCR master mix62.264.463.32.2
Primer-BLAST default59.460.259.80.8

qPCR master mix: Owczarzy 2004/2008 · 250 nM primer · 50 mM Na⁺ · 3 mM Mg²⁺ · 0.8 mM dNTP

Primer-BLAST default: SantaLucia 1998 salt corr. · 50 nM primer · 50 mM Na⁺ · 1.5 mM Mg²⁺ · 0.6 mM dNTP

Bold, underlined base = 3′ end (polymerase extension point).

Primer QC

GC% · Forward

43.5%

GC% · Reverse

57.9%

Self-dimer ΔG · Fwd (any position)

-3.0 kcal/mol

Self-dimer ΔG · Fwd (3′ end)

0.5 kcal/mol

Self-dimer ΔG · Rev (any position)

-2.2 kcal/mol

Self-dimer ΔG · Rev (3′ end)

0.5 kcal/mol

Heterodimer ΔG (F×R, any position)

-2.2 kcal/mol

Heterodimer ΔG (F×R, 3′ end)

0.5 kcal/mol

ΔG at 37 °C · SantaLucia 1998 NN parameters · < −6 kcal/mol = significant dimer risk · "3′ end" is restricted to duplexes anchored at a primer's own 3′ terminal base (polymerase-extendable); "any position" is the most stable duplex anywhere in the primer. Estimated screening value. For comprehensive dimer analysis, validate with Primer3.

Source

PMID

41423554(Europe PMC)

Citation

Huangfu et al. 2025

Genomic mapping

Ensembl gene

ENSMUSG00000018476 ↗

NCBI Gene ID

216850

Assembly

GRCm39

Cross-check

★ = Ensembl canonical transcript (reference model, not necessarily the most expressed isoform)

Showing: ENSMUST00000094077 ★

143bp15.0kb118bp2522bp144bp3374bp142bp4425bp99bp5413bp220bp6407bp93bp7343bp162bp8447bp204bp9640bp351bp102.6kb2.2kb112.4kb127bp12337bp106bp131.6kb206bp14363bp65bp15221bp72bp16314bp149bp17399bp115bp18383bp188bp19472bp142bp20651bp127bp21381bp171bp221.6kb1.3kb23FRPredicted from the amplicon's own GC%+length (von Ahsen et al. 2001, at the same qPCR buffer as the primer Tm above: 50 mM Na⁺ plus 3 mM Mg²⁺ less 0.8 mM dNTP, as a sodium equivalent), not the SantaLucia model used for primer Tm, which isn't valid at this length. A screening estimate for ranking amplicons — that relation was fitted on oligonucleotide duplexes, so applying it at amplicon length carries more error than its published ±1.9 °C, and it is not a melt-peak prediction.142 bp amplicon · predicted amplicon Tm 86.4 °C
Kdm6b · ENSMUST00000094077 (NM_001017426) · canonical⚠ Exon-junction spanning · gDNA product still possible (300bp–1.0kb intron)

Off-target specificity

Off-target? (genomic)

1 candidate off-target amplicon(s) found against nt (Mus musculus) besides the target gene — 0 on a confirmed RefSeq transcript, 1 on genomic/uncurated sequence only — review before approving.

Efficiency measurements

Ideal range:Dilution series 1.90–2.10·LinRegPCR 1.70–1.90·unknown method: not scored
No measurements yet for this primer pair.

Using these primers?

Analyse your qPCR run with LinRegPCR efficiency correction and a MIQE 2.0 report.

Analyse your data →