★ Founders price. 40% off the first two years of an annual plan started by June 30, 2027, then the standard price. See the plans →
← Primer database

Primer database

Rn18s

18S ribosomal RNA

Mus musculus

PublicationReinehr et al. 2023

Sequences

Forward (5′→3′)

GCAATTATTCCCCATGAACG

Reverse (5′→3′)

GGGACTTAATCAACGCAAGC

Amplicon

68 bp

Primer Tm (°C)

ConditionsForwardReverseAverageΔ F/R
qPCR master mix58.360.759.52.4
Primer-BLAST default55.157.556.32.4

qPCR master mix: Owczarzy 2004/2008 · 250 nM primer · 50 mM Na⁺ · 3 mM Mg²⁺ · 0.8 mM dNTP

Primer-BLAST default: SantaLucia 1998 salt corr. · 50 nM primer · 50 mM Na⁺ · 1.5 mM Mg²⁺ · 0.6 mM dNTP

Bold, underlined base = 3′ end (polymerase extension point).

Primer QC

GC% · Forward

45.0%

GC% · Reverse

50.0%

Self-dimer ΔG · Fwd (any position)

-1.9 kcal/mol

Self-dimer ΔG · Fwd (3′ end)

-0.2 kcal/mol

Self-dimer ΔG · Rev (any position)

-0.6 kcal/mol

Self-dimer ΔG · Rev (3′ end)

-0.3 kcal/mol

Heterodimer ΔG (F×R, any position)

-3.0 kcal/mol

Heterodimer ΔG (F×R, 3′ end)

-0.3 kcal/mol

ΔG at 37 °C · SantaLucia 1998 NN parameters · < −6 kcal/mol = significant dimer risk · "3′ end" is restricted to duplexes anchored at a primer's own 3′ terminal base (polymerase-extendable); "any position" is the most stable duplex anywhere in the primer. Estimated screening value. For comprehensive dimer analysis, validate with Primer3.

Source

PMID

36733392(Europe PMC)

Citation

Reinehr et al. 2023

Genomic mapping

Ensembl gene

ENSMUSG00000119584 ↗

NCBI Gene ID

19791

Assembly

GRCm39

Cross-check

★ = Ensembl canonical transcript (reference model, not necessarily the most expressed isoform)

Showing: ENSMUST00000240377 ★rRNA

1.8kb1FRPredicted from the amplicon's own GC%+length (von Ahsen et al. 2001, at the same qPCR buffer as the primer Tm above: 50 mM Na⁺ plus 3 mM Mg²⁺ less 0.8 mM dNTP, as a sodium equivalent), not the SantaLucia model used for primer Tm, which isn't valid at this length. A screening estimate for ranking amplicons — that relation was fitted on oligonucleotide duplexes, so applying it at amplicon length carries more error than its published ±1.9 °C, and it is not a melt-peak prediction.68 bp amplicon · predicted amplicon Tm 81.7 °C
Rn18s · ENSMUST00000240377 · canonicalrRNA⚠ Single-exon · may amplify genomic DNA

Off-target specificity

Specific

No paired forward+reverse off-target amplicon found against nt (whole genome/transcriptome). Screen requires >=2 total mismatches including >=2 within the last 5bp at the 3' end to clear a hit (NCBI Primer-BLAST-style stringency); hits with >=6 total mismatches are dropped as implausible.

Efficiency measurements

Ideal range:Dilution series 1.90–2.10·LinRegPCR 1.70–1.90·unknown method: not scored
No measurements yet for this primer pair.

Using these primers?

Analyse your qPCR run with LinRegPCR efficiency correction and a MIQE 2.0 report.

Analyse your data →